Final Assessment Questions (40 of 45) SUBMIT A data governance system is effective if:
O Anyone can access the data when they need it.
O There are strict rules prohibiting access to data.
O Data used in decision making is of consistent quality and from reliable sources
O There are no data breaches.

Answers

Answer 1

A data governance system is effective if anyone can access the data when they need it. Thus option (A) is correct.

What is data?

The data is the processed form of raw information, more specifically it has facts, figures, measurements and amounts that is gathered for analysis or reference. So that a conclusion can be drawn in a proper way.

The data, especially facts or numbers, collected to be examined and considered and used to help decision-making, and the data can be stored in an electronic form  in the database and used by a computer in the future.

Like a data governance system is effective if anyone can access the data when they need it. Therefore option (A) is correct.

Learn more about data here:

https://brainly.com/question/15403824

#SPJ4


Related Questions

A loan made to the government that pays a fixed amount of interest at a
certain time is a
A. savings account
B. bond
C. stock
D. hedge fund

Answers

Answer:

B. Bond

Explanation:

Did the test.

When a loan made to the government which provides a fixed amount of interest at the end of the period, then that is treated as a bond.

Option B is correct.

What is an interest?

An interest is a kind of charge being levied on the borrowed funds till its maturity. It can be based on monthly, yearly or quarterly depending upon the lender.

A type of financial security that is being tradeable in the stock market is called a bond. It can be issued by the companies or even sometimes the government in the monetary market. The investors who acquire the bonds for certain period of time, usually five years, then those investors are called as bond investors or bondholders.When the term of bond ends, that is, the maturity period, then the bond investor gets the principal amounts along with interest. There are various categories of bonds issued with varying maturities and features.

Therefore, the description written in option B is correct.

Learn more about bonds in the related link:

https://brainly.com/question/13559242

#SPJ5

Which statement best explains why the United States grew into a world
economic power in the 20th century?
O A. The United States prevented other countries from abandoning the
gold standard.
O B. The United States increased its participation in international trade.
C. The United States put effective trade barriers in place to limit trade
with other nations.
D. The United States stayed out of major world wars and instead
made economic investments.

Answers

Answer:

B. The United States increased its participation in international trade.

Explanation:

The correct option is - B. The United States increased its participation in international trade.

Why do corporations, companies, and government agencies use formal application forms?

Answers

Answer:

due to the amount of employment requests , they need a uniform document to organize records and identify candidates' skills

Explanation:

IZSA
11. Laser Research, Inc., is sending their five-person research team to a three-day conference to
learn a new automated lab procedure. One researcher earns $336 daily, two earn $360 daily.
and two earn $390 daily. What will the three-day conference cost Laser Research, Ine, in
lost productivity for the five researchers?

Answers

Answer:

The three-day conference will cost Laser Research, Inc. $ 5,508 in lost productivity.

Explanation:

Given that Laser Research, Inc., is sending their five-person research team to a three-day conference to learn a new automated lab procedure, and one researcher earns $ 336 daily, two earn $ 360 daily and two earn $ 390 daily, to determine what will the three-day conference cost Laser Research, Inc, in lost productivity for the five researchers, the following calculation should be performed:

336 x 3 + 360 x 2 x 3 + 390 x 2 x 3 = X

1,008 + 720 x 3 + 780 x 3 = X

1,008 + 2,160 + 2,340 = X

5.508 = X

Thus, the three-day conference will cost Laser Research, Inc. $ 5,508 in lost productivity.

A assessment may alter the content of a sales pitch.

True
False

Answers

The answer is true

This is because a assessment is a process of determining needs, and or gaps between conditions. And a sales pitch is a sales presentation where a salesperson explains the benefits of their business.

Knowing all of this information, a needs assessment can alter the content of a sales pitch.

Aleisha wants to buy a condominium. She has the choice of buying it now or renting it with the option to buy at the end of 4 years. If she rents now, she must pay a deposit of $1,500 and pay rent of $865 per month. If she buys, she would need closing costs and her mortgage payment would be $844 a month for 4 years. How much would her closing costs need to be in order for the cost to buy to be the same as the cost to rent

Answers

Answer:correct option is b. $2,508Step-by-step explanation:given datafor rent deposit = $1,500rent = $865 per monthtime = 4 yearmortgage payment = $844to find outHow much would her closing costs need to order for the cost to buy to same as cost to rentsolutionfirst we get here Total payment by monthly payment for 4 year rent isTotal payment = $865 × 4 year × 12 monthsTotal payment for rent = $41520and so the total amount pay in rent istotal amount pay in rent = Amount deposited + Total payment   ..............1total amount pay in rent = $1500 + $41520total amount pay in rent = $43020andnow we get total payment by monthly payment for 4 year when buytotal payment =  $844 × 4 year × 12 monthstotal payment for buy = $40512and now we consider here closing costs for buying =  xsototal amount pay in buy = total payment + closing costs   ..............2total amount pay in buy = $40512 + xso here cost to buy to be same as cost to rent so$40512 + x = $43020x = $2508so here closing costs will be $2508so correct option is b. $2,508:

a A rocket shoots up 123 meter
i. What is its initial velocity -​

Answers

Answer:

Initial Velocity= 49 m/s

Time period= 5 secs

Explanation:

THIS IS THE COMPLETE QUESTION BELOW

A rocket shoots up 123 meters. What is it initial velocity?How long is it ascending

The initial velocity can be calculated using the expression below

u= √( 2gh)

Where g= Acceleration due to gravity= 98 m/s^2

h= height

Substitute the values we have

u = √(2*9.8*123)

u=√( 2410.8)

u = 49 m/s

the time period can be calculated as

(49/9.8)

= 5 sec

Hence time period is 5 secs

Which is considered a tertiary source?

A.) A Wikipedia article

B.) An autobiography

C.) A government record

D.) A journal entry

Answers

Answer:

A Wikipedia article.

Explanation:

A tertiary source are sources that compile info from other sources.

Answer:

B. An autobiography

Explanation:

It's a 3rd person source

Question 11 of 40
Which of these is most likely to threatened a company's financial security?
A. shoplifting
B. social security numbers
C. infringement
D. embezzlement
SUBMIT

Answers

Social security numbers I do believe! :)

Answer: I’m pretty sure it’s D. embezzlement.

Explanation:

Embezzlement is described as theft or misappropriation of funds placed in one's trust or belonging to one's employer. Not sure though!

Read the scenario below and then answer the question. Sample scenario: Scientists have created a new grass seed that stops grass growth at a specific length, eliminating the need to mow the lawn. The price of this seed is high, but many consumers still want to use it. As a result, several different producers supply a large amount of this seed to consumers. In order to attract consumers to their product, some producers lower their prices and supply fewer bags of seeds. What is the best description of the grass seed that is described in this scenario

Answers

Answer: a good with an elastic supply

Explanation:

Price elasticity of supply simply refers to how the changes in market price of a good bring about a responsiveness to the supply of such good.

Based on the information given, the best description of the grass seed that is described in this scenario is that it's a good that has an elastic supply. This is because the price of the good in thus case, is sensitive to the changes in the price.

Answer:

It's a good with an elastic supply

Explanation:

edge 2021

Personal selling used to be more common.

True
False

Answers

The answer is true as in true
Answer : true personal selling used to be more common


Tom is the aerobics coordinator at a fitness center. He needs a more efficient way for his instructors to share information. Class schedules are updated on a regular basis. Instructors need to indicate when they cannot teach a class and other instructors need to be able to sign up to cover the class. Instructors also often attend training classes and learn new procedures. Having a place to share their learning and update procedures will benefit them and their clients. Cindy is taking a business class and told Tom about a great tool that will serve their needs. What was the technology tool Cindy told Tom about

Answers

Answer:

wikis technological tool

Explanation:

As regards to the case above, the technology tool Cindy told Tom about is wikis technological tool . A wiki can be regarded as collaborative tool that provides students with enablement to make contribution and to perform modifications on one or more than one pages of course related materials. This tool is collaborative in nature, as a result of this, it facilitate community-building within a course. a wiki can be regarded as a web page and a collaborative software that has an open-editing system. It was set up to

the lexicon by Ward Cunningham who was a programmer

2. The owner of a franchise benefits from brand name recognition, access to professional
and nationwide advertising.

Answers

Answer:

True

Explanation:

It is TRUE that the owner of a franchise benefits from brand name recognition, access to professional and nationwide advertising.

This is because the owner of a franchise has various advantages. The advantages include enhanced reputation which covers all the places there is a franchise.

Then there is an increase in management techniques and work practices, including access to national advertising to cover many places and continuous support.

You can buy a computer with your credit card and pay for it over the course of one year. With an interest rate of 16 percent, you would need to pay $181.46 for 12 months to pay off the charge. You can rent the computer for 12 months for $200 per month and, at the end of the rent period, buy it for $300. How much will you save by purchasing the computer with your credit card instead of using the rent-to-own plan?

Answers

Answer:

you can save $522.48 by purchasing the computer with the credit card

Explanation:

total money paid to the credit card company = $181.46 x 12 = $2,177.52

total money paid for renting the computer = $200 x 12 = $2,400, plus the final payment = $2,400 + $300 = $2,700

money saved by using the credit card = $2,700 - $2,177.52 = $522.48

Forrester Company is considering buying new equipment that would increase monthly fixed costs from $120,000 to $150,000 and would decrease the current variable costs of $70 by $10 per unit. The selling price of $100 is not expected to change. Forrester's current break-even sales are $400,000 and current break-even units are 4,000. If Forrester purchases this new equipment, the revised break-even point in units would:

Answers

Answer:

"Decrease by 250" is the appropriate response.

Explanation:

The given values are:

Revised fixed cost,

= $150,000

Current selling price,

= $100

Current variable cost,

= $60

Current contribution will be:

=  [tex]Current \ selling \ price-Current \ variable \ cost[/tex]

=  [tex]100-60[/tex]

=  [tex]40[/tex]

Now,

The revised BEP will be:

=  [tex]\frac{Revised \ fixed \ cost}{Revised \ contribution}[/tex]

On substituting the values, we get

=  [tex]\frac{150,000}{40}[/tex]

=  [tex]3750 \ units[/tex]

hence,

=  [tex]4000-3750[/tex]

=  [tex]250[/tex]

Thus the above is the correct answer.

What is another name for administrative law?

Answers

Answer:

Regulatory law

Explanation:

Administrative law is an arm of public law and is also known as “regulatory law.”

Emily and Steffi work at Education Yours, a nonprofit educational institution. Steffi, newly hired on a temporary teaching assignment, was asked last month by her supervisor to teach an online course. Being new to online teaching, Steffi is considering her efficacy. She talks to Emily and other individuals who have been teaching online for several years. Emily takes pride in her teaching and always approaches her teaching with total enthusiasm. Emily tells Steffi that she believes exerting a high level of effort will result in a successful performance in her online teaching. Which of the following best describes Emily's belief about exerting a high level of effort?
A. Equity
B. Instrumentality
C. Expectancy
D. Emotional cues
E. Valence

Answers

Answer: expectancy

Explanation:

The option that describes Emily's belief about exerting a high level of effort is "expectancy".

Expectancy theory, simply suggests that the behavior of people are motivated as a result of the results that they expect.

Therefore, Emily's belief that a high level of effort will result in a successful performance in her online teaching shows that she's motivated based in what she wants to achieve which is what the expectancy theory entails.

ESTIONS
Discuss FOUR phases of business cycle in detail​

Answers

Answer:

The answer is below

Explanation

1. Expansion: this is a period in which business is growing at a considerable rate. Such as an increase in production and sales

2. peak: this is a period in which production and prices increase beyond the normal level. This shows there is no longer room for increment.

3. contraction: this is a period in a business cycle in which the productions and sales began to fall due to low patronage and a bad economy.

4. Trout: this is a peak period in which business models lost their values in terms of production and sales. At this point, it is believed that the business cannot get worse.

Businesses like to keep operating costs as low as possible, so they can focus on
production and profit. One way to keep operating costs down is to keep wages
low. Many businesses pay their workers the minimum wage required by law.
Often; workers consider this unfair and feel they should be paid more than the
bare minimum for the work they do. Paying employees the minimum wage is
certainly not illegal, but is it always ethical? What do you think?*

Answers

Answer:

No I don't think it is very ethical to only be paying employees minimum wage. The cost of living keeps going up and people need to be able to afford the basic necessities of life. The prices of everyday goods like groceries and household basics keep going up making it hard for people to be able to afford them especially when they are only making minimum wage. When the product cost is higher, the company is making more profit, therefore they are able to pay their workers more. When the prices of goods and products increase, wages should increase as well.

Explanation:

pls can someone buy me the upgrade i beg youuu :(

Answers

what upgrade are you talking about

Answer:

no

Explanation:

How do businesses compete for customers?

Answers

Answer:

marketing team and review resources

If you could completely remove something you put online forever, what would it be?

Answers

Answer: Nothing, I just want it all if I would remove something I would of tell you. But I don’t. :)

Explanation:

Which of the following is a true statement?
1) FAS Market Development and Export Assistance partners with over 100 cooperator groups
2) FTC stands for Federal Trade Commission
3) FAS stands for Federal Agricultural Sector
4) Imports are goods produced in one country then shipped to another country​

Answers

Answer:

2) FTC stands for Federal Trade Commission

Explanation:

The true statement is that, FTC stands for Federal Trade Commission.

The Federal Trade Commission (FTC) is an agency of the government of the United States of America saddled with the responsibility of promoting consumer protection and the enforcement of all civil antitrust laws.

Basically, the laws formulated or established by the FTC are to provide protection for consumers of various goods and services while requiring that businesses do not make false claims about them. Also, the Federal Trade Commission (FTC) is responsible for competition regulations among manufacturers of goods and services provided for the consumers.

Which of the following laws limits the hours and types of duties in which teens can work​

Answers

Fair Labor Standards Act

The Two types of wills are:
- formal and holographic
- legal and fake
- formal and casual
- none of the above

Answers

3 won I think if not sorry

30 points please help!
Olive's organic Baby food believes their reputation is being put down by a competitor because of their untruthful advertising. Which of the following types of business tort is this?
a. fra ud
b. crim inal
c. defam ation

Answers

Answer:

i believe is fraud

Explanation:

if you find it helpful pls give me the points

Pete would like to respond only to users within his organization with an automatic reply. He is configuring the automatic response. Which option should he select?

answer b

Answers

Answer: B: Inside my organization tab

Explanation: edge 2021 unit review

Suppose the city of Austin, TX chooses to regulate the number of street vendors operating near the University of Texas by requiring each vendor to own a permit in order to operate. The city gives free permits to all existing vendors and announces that no new permits will ever be issued. Prior to regulation, the costs (including implicit costs) of operating were $85,000 and revenues were $150,000. The city ordinance allows the permits to be bought and sold without restriction. The permits have no expiration date. The interest rate is 10 percent. After regulation, existing street vendors earn an
A. accounting profit of zero.
B. economic profit of $130,000.
C. economic rent of $65,000
D. economic loss.

Answers

Answer:

economic rent of $65,000

Explanation:

Economic rent is the amount of money paid in excess to a factor of production in excess of what is socially optimum

Economic rent = $150,000 - $85,000 = $65,000

Accounting profit= total revenue - explicit cost

Total revenue =price x quantity sold  

Explicit cost includes the amount expended in running the business. They include rent , salary and cost of raw materials

Economic profit = accounting profit - implicit cost

Implicit cost is the cost of the next best option forgone when one alternative is chosen over other alternatives

Without the regulation, economic profit would be driven to zero.

Often, an objection is simply a request for

A. a discount

B. a different salesperson

C. more time

D. more information

Answers

Answer:

C. and D.

Explanation:

An Objection is when a certain something strongly disagrees with a reasoning But that reasoning can be very challanging to be dealt with. an expression or feeling of disapproval or opposition; a reason for disagreeing.

Budgeting for needs
Select the items that are needs from your credit card statement
Last Month
Groceries $200
Movie rentals $15
Concert Tickets $120
Internet Services $60
Fitness Class $35
Go-Kart racing $50

I've tried so many combinations and none of them work. I assume groceries is 100% one of the options. Can't seem to find the others.

Answers

Answer:

groceries

Explanation:

Other Questions
What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential